Information in SFARI Gene Archive will no longer be updated. To view the most up to date information, visit SFARI Gene.

Human Gene Module / Chromosome 16 / ANKRD11

ANKRD11ankyrin repeat domain 11

Score
1S
High Confidence, Syndromic Criteria 1.1, Syndromic
Autism Reports / Total Reports
12 / 41
Rare Variants / Common Variants
58 / 0
Aliases
ANKRD11, T13,  LZ16,  ANCO-1
Associated Syndromes
KBG syndrome, Cornelia de Lange syndrome
Genetic Category
Rare Single Gene Mutation, Syndromic
Chromosome Band
16q24.3
Associated Disorders
EPS, ID, ASD, ADHD, DD/NDD
Relevance to Autism

Studies have identified rare mutations in the ANKRD11 gene with autism.

Molecular Function

This locus encodes an ankryin repeat domain-containing protein. The encoded protein inhibits ligand-dependent activation of transcription. Mutations in this gene have been associated with KBG syndrome, which is characterized by macrodontia, distinctive craniofacial features, short stature, skeletal anomalies, global developmental delay, seizures and intellectual disability.

External Links
Gene CardPubMed
Human
Entrez GeneOMIMUniProtHumanBase
Mouse
Entrez GeneMouse Genome InformaticsAllen Brain Atlas
Reports related to ANKRD11 (41 Reports)
# Type Title Author, Year Autism Report Associated Disorders
1 Highly Cited Identification of a novel family of ankyrin repeats containing cofactors for p160 nuclear receptor coactivators. Zhang A , et al. (2004) No -
2 Recent Recommendation Subcellular localization of ankyrin repeats cofactor-1 regulates its corepressor activity. Zhang A , et al. (2007) No -
3 Primary Structural variation of chromosomes in autism spectrum disorder. Marshall CR , et al. (2008) Yes -
4 Recent Recommendation Ankyrin repeats-containing cofactors interact with ADA3 and modulate its co-activator function. Li CW , et al. (2008) No -
5 Recent Recommendation Identification of ANKRD11 as a p53 coactivator. Neilsen PM , et al. (2008) No -
6 Support Identification of ANKRD11 and ZNF778 as candidate genes for autism and variable cognitive impairment in the novel 16q24.3 microdeletion syndrome. Willemsen MH , et al. (2009) Yes -
7 Support Haploinsufficiency of ANKRD11 causes mild cognitive impairment, short stature and minor dysmorphisms. Isrie M , et al. (2011) No ADHD
8 Support Mutations in ANKRD11 cause KBG syndrome, characterized by intellectual disability, skeletal malformations, and macrodontia. Sirmaci A , et al. (2011) No ID
9 Support Massively parallel sequencing of patients with intellectual disability, congenital anomalies and/or autism spectrum disorders with a targeted gene ... Brett M , et al. (2014) Yes MCA
10 Support Genetic heterogeneity in Cornelia de Lange syndrome (CdLS) and CdLS-like phenotypes with observed and predicted levels of mosaicism. Ansari M , et al. (2014) No -
11 Support Efficient strategy for the molecular diagnosis of intellectual disability using targeted high-throughput sequencing. Redin C , et al. (2014) No -
12 Support De novo insertions and deletions of predominantly paternal origin are associated with autism spectrum disorder. Dong S , et al. (2014) No -
13 Support The contribution of de novo coding mutations to autism spectrum disorder. Iossifov I , et al. (2014) Yes -
14 Recent Recommendation Further delineation of the KBG syndrome phenotype caused by ANKRD11 aberrations. Ockeloen CW , et al. (2014) No ASD, ID, ADHD, epilepsy
15 Support Effectiveness of exome and genome sequencing guided by acuity of illness for diagnosis of neurodevelopmental disorders. Soden SE , et al. (2014) No -
16 Support Large-scale discovery of novel genetic causes of developmental disorders. Deciphering Developmental Disorders Study (2014) Yes -
17 Recent Recommendation Ankrd11 is a chromatin regulator involved in autism that is essential for neural development. Gallagher D , et al. (2015) No -
18 Support Whole exome sequencing in females with autism implicates novel and candidate genes. Butler MG , et al. (2015) Yes -
19 Support Broadening of cohesinopathies: exome sequencing identifies mutations in ANKRD11 in two patients with Cornelia de Lange-overlapping phenotype. Parenti I , et al. (2015) No -
20 Recent Recommendation Low load for disruptive mutations in autism genes and their biased transmission. Iossifov I , et al. (2015) Yes -
21 Support Exome sequencing in mostly consanguineous Arab families with neurologic disease provides a high potential molecular diagnosis rate. Charng WL , et al. (2016) No -
22 Support Meta-analysis of 2,104 trios provides support for 10 new genes for intellectual disability. Lelieveld SH , et al. (2016) No -
23 Support Clinical and molecular findings in 39 patients with KBG syndrome caused by deletion or mutation of ANKRD11. Goldenberg A , et al. (2016) No -
24 Support High diagnostic yield of syndromic intellectual disability by targeted next-generation sequencing. Martnez F , et al. (2016) No ID, autistic behavior, stereotypic behavior
25 Support Mutations in Human Accelerated Regions Disrupt Cognition and Social Behavior. Doan RN , et al. (2016) Yes -
26 Support Clinical and genetic aspects of KBG syndrome. Low K , et al. (2016) No -
27 Support De novo genic mutations among a Chinese autism spectrum disorder cohort. Wang T , et al. (2016) Yes -
28 Support Clinical exome sequencing: results from 2819 samples reflecting 1000 families. Trujillano D , et al. (2016) No -
29 Support KBG syndrome involving a single-nucleotide duplication in ANKRD11. Kleyner R , et al. (2016) No ASD, ID, epilepsy/seizures
30 Support ANKRD11 variants cause variable clinical features associated with KBG syndrome and Coffin-Siris-like syndrome. Miyatake S , et al. (2017) No -
31 Support Whole genome sequencing resource identifies 18 new candidate genes for autism spectrum disorder. C Yuen RK , et al. (2017) Yes -
32 Support A clinical utility study of exome sequencing versus conventional genetic testing in pediatric neurology. Vissers LE , et al. (2017) No -
33 Support Genomic diagnosis for children with intellectual disability and/or developmental delay. Bowling KM , et al. (2017) Yes -
34 Support Improved diagnostic yield compared with targeted gene sequencing panels suggests a role for whole-genome sequencing as a first-tier genetic test. Lionel AC , et al. (2017) No -
35 Support High Rate of Recurrent De Novo Mutations in Developmental and Epileptic Encephalopathies. Hamdan FF , et al. (2017) No DD/ID
36 Support Exome Pool-Seq in neurodevelopmental disorders. Popp B , et al. (2017) No Microcephaly
37 Support Diagnostic exome sequencing of syndromic epilepsy patients in clinical practice. Tumien B , et al. (2017) No Specific learning disability
38 Support Integrative Analyses of De Novo Mutations Provide Deeper Biological Insights into Autism Spectrum Disorder. Takata A , et al. (2018) Yes -
39 Recent Recommendation Diagnosis and management of Cornelia de Lange syndrome: first international consensus statement. Kline AD , et al. (2018) No -
40 Support Prominent and elongated coccyx, a new manifestation of KBG syndrome associated with novel mutation in ANKRD11. De Bernardi ML , et al. (2018) No -
41 Support The combination of whole-exome sequencing and copy number variation sequencing enables the diagnosis of rare neurological disorders. Jiao Q , et al. (2019) No -
Rare Variants   (58)
Status Allele Change Residue Change Variant Type Inheritance Pattern Parental Transmission Family Type PubMed ID Author, Year
delT - intron_variant - - Unknown 27667684 Doan RN , et al. (2016)
- - copy_number_loss De novo - - 19920853 Willemsen MH , et al. (2009)
- - copy_number_loss De novo - Simplex 21654729 Isrie M , et al. (2011)
- - copy_number_loss De novo - Simplex 18252227 Marshall CR , et al. (2008)
c.6623C>A p.Ser2208Ter stop_gained De novo - - 30945278 Jiao Q , et al. (2019)
c.2512C>T p.Arg838Ter stop_gained Unknown - - 28771251 Lionel AC , et al. (2017)
c.6187G>T p.Glu2063Ter stop_gained De novo - - 28250421 Miyatake S , et al. (2017)
c.6472G>T p.Glu2158Ter stop_gained De novo - - 28554332 Bowling KM , et al. (2017)
c.2751dup p.Glu918Ter stop_gained De novo - - 25424714 Ockeloen CW , et al. (2014)
c.7570-2A>G p.? splice_site_variant De novo - - 27848944 Trujillano D , et al. (2016)
c.2512C>T p.Arg838Ter stop_gained De novo - Simplex 29100083 Hamdan FF , et al. (2017)
c.7189C>T p.Gln2397Ter stop_gained De novo - Simplex 21782149 Sirmaci A , et al. (2011)
c.5317G>T p.Glu1773Ter stop_gained De novo - Simplex 27435318 Charng WL , et al. (2016)
c.6184del p.Leu2062fs frameshift_variant De novo - - 25424714 Ockeloen CW , et al. (2014)
c.6513dup p.Gly2172fs frameshift_variant De novo - - 25424714 Ockeloen CW , et al. (2014)
c.389A>G p.Asn130Ser missense_variant Familial Paternal - 27824329 Wang T , et al. (2016)
c.4965del p.Glu1656fs frameshift_variant De novo - - 27479843 Lelieveld SH , et al. (2016)
c.7595A>C p.Gln2532Pro missense_variant De novo - Simplex 29346770 Takata A , et al. (2018)
c.6793delC p.Ala2265Profs frameshift_variant De novo - - 28554332 Bowling KM , et al. (2017)
c.6868C>T p.Pro2290Ser missense_variant Familial Maternal - 24690944 Brett M , et al. (2014)
c.4964_4965del p.Lys1655fs frameshift_variant De novo - - 28333917 Vissers LE , et al. (2017)
c.1460_1463del p.Glu487fs frameshift_variant Unknown - - 25424714 Ockeloen CW , et al. (2014)
c.1903_1907del p.Lys635fs frameshift_variant De novo - - 25424714 Ockeloen CW , et al. (2014)
c.1382C>G p.Thr461Arg missense_variant Unknown - Multiplex 25574603 Butler MG , et al. (2015)
c.3123_3126del p.Ile1042fs frameshift_variant De novo - - 25424714 Ockeloen CW , et al. (2014)
c.3382_3383del p.Asp1128fs frameshift_variant De novo - - 25424714 Ockeloen CW , et al. (2014)
c.4391_4392del p.Lys1464fs frameshift_variant De novo - - 25424714 Ockeloen CW , et al. (2014)
c.2092_2096del p.Glu698fs frameshift_variant De novo - - 27479843 Lelieveld SH , et al. (2016)
c.2398_2401del p.Leu802fs frameshift_variant De novo - - 27479843 Lelieveld SH , et al. (2016)
c.2175_2178del p.Asn725fs frameshift_variant De novo - Simplex 25284784 Dong S , et al. (2014)
c.4374delG p.Glu1458fs frameshift_variant Unknown - Simplex 28263302 C Yuen RK , et al. (2017)
c.5174dupC p.Pro1725fs frameshift_variant Unknown - Simplex 28263302 C Yuen RK , et al. (2017)
c.1903_1907del p.Lys635GlnfsTer26 frameshift_variant De novo - - 29158550 Popp B , et al. (2017)
c.1903_1907del p.Lys635fs frameshift_variant De novo - Simplex 25363768 Iossifov I , et al. (2014)
c.2305delT p.Ser769GlnfsTer8 frameshift_variant De novo - Simplex 21782149 Sirmaci A , et al. (2011)
c.1318C>T p.Arg440Ter stop_gained Familial - Multi-generational 25424714 Ockeloen CW , et al. (2014)
c.4083C>A p.His1363Gln missense_variant Familial Maternal Multiplex 25167861 Redin C , et al. (2014)
c.1385_1388delCAAA p.Thr462LysfsTer47 frameshift_variant De novo - - 25473036 Soden SE , et al. (2014)
c.3224_3227del p.Glu1075GlyfsTer242 frameshift_variant De novo - - 28250421 Miyatake S , et al. (2017)
c.3832A>T p.Lys1278Ter stop_gained Familial - Multi-generational 25424714 Ockeloen CW , et al. (2014)
c.6015dupA p.Gly2006ArgfsTer26 frameshift_variant De novo - Simplex 27900361 Kleyner R , et al. (2016)
c.1903_1907del p.Lys635GlnfsTer26 frameshift_variant De novo - Simplex 28250421 Miyatake S , et al. (2017)
c.5953_5954delCA p.Gln1985GlufsTer46 frameshift_variant De novo - Simplex 21782149 Sirmaci A , et al. (2011)
c.1801C>T p.Arg601Ter stop_gained De novo - Simplex 25533962 Deciphering Developmental Disorders Study (2014)
c.6416C>T p.Pro2139Leu missense_variant Familial Maternal Multi-generational 28250421 Miyatake S , et al. (2017)
c.4528_4529delCC p.Pro1510AlafsTer43 frameshift_variant De novo - Simplex 30088855 De Bernardi ML , et al. (2018)
c.7481dup p.Pro2495fs frameshift_variant Familial Maternal Multi-generational 25424714 Ockeloen CW , et al. (2014)
c.3582delG p.Gly1194fs frameshift_variant De novo - Simplex 25533962 Deciphering Developmental Disorders Study (2014)
c.6071_6084delCGTACGCTCTGCCC p.Pro2024ArgfsTer3 frameshift_variant De novo - Simplex 21782149 Sirmaci A , et al. (2011)
c.4475_4498dupTCCTGCGGCATCACAGGGACGAGC p.Leu1492_Glu1499dup inframe_insertion De novo - - 29286531 Tumien B , et al. (2017)
c.7570-1G>C p.Glu2524_Lys2525del splice_site_variant Familial Paternal Multi-generational 21782149 Sirmaci A , et al. (2011)
c.2408_2412del p.Lys803ArgfsTer5 frameshift_variant De novo - Simplex 25533962 Deciphering Developmental Disorders Study (2014)
c.3703_3706del p.Lys1235ArgfsTer82 frameshift_variant De novo - Simplex 25533962 Deciphering Developmental Disorders Study (2014)
p.4103_4104del p.Lys1368ArgfsTer17 frameshift_variant De novo - Simplex 25533962 Deciphering Developmental Disorders Study (2014)
c.3436_3461del p.Thr1146LysfsTer164 frameshift_variant De novo - Simplex 25533962 Deciphering Developmental Disorders Study (2014)
c.3369_3372delTGAG p.Ser1123ArgfsTer194 frameshift_variant Familial Paternal Multi-generational 27620904 Martnez F , et al. (2016)
c.2407_2412delAAAAAAinsA p.Lys803ArgfsTer5 frameshift_variant De novo - Simplex 25533962 Deciphering Developmental Disorders Study (2014)
c.1897_1907delAAAACAAAACinsAAAACA p.Lys635GlnfsTer26 frameshift_variant De novo - Simplex 25533962 Deciphering Developmental Disorders Study (2014)
Common Variants  

No common variants reported.

SFARI Gene score
1S

High Confidence, Syndromic

2S

Score Delta: Score remained at 2.1 + S

criteria met
See SFARI Gene'scoring criteria
1

High Confidence

See all Category 1 Genes

We considered a rigorous statistical comparison between cases and controls, yielding genome-wide statistical significance, with independent replication, to be the strongest possible evidence for a gene. These criteria were relaxed slightly for category 2.

S

Syndromic

See all Category S Genes

The syndromic category includes mutations that are associated with a substantial degree of increased risk and consistently linked to additional characteristics not required for an ASD diagnosis. If there is independent evidence implicating a gene in idiopathic ASD, it will be listed as "#S" (e.g., 2S, 3S, etc.). If there is no such independent evidence, the gene will be listed simply as "S."

4/1/2018
2S
icon
2.1 + S

Score remained at 2.1 + S

Description

2S

Reports Added
[Diagnostic exome sequencing of syndromic epilepsy patients in clinical practice.2017] [Integrative Analyses of De Novo Mutations Provide Deeper Biological Insights into Autism Spectrum Disorder.2018]
10/1/2017
2S
icon
2S

Score remained at 2S

Description

ANKRD11 is in an ASD-associated multi-genic CNV on chromosome 16q24.3 (Willemsen et al., 2010; Marshall et al., 2008). Two de novo LoF variants in the ANKRD11 gene (both frameshift) have been identified in ASD probands from the Simons Simplex Collection (PMIDs 25284784, 25363768). Mutations in ANKRD11 are also responsible for KBG syndrome (OMIM 148050), which is characterized by developmental delay/intellectual disability and, in some cases, autism (PMID 21782149, 19597979). A comprehensive clinical and genetic evaluation of 20 patients with KBG syndrome from 13 families published in 2014 found that many patients displayed behavioral abnormalities such as ASD (PMID 25424714). In this report, de novo LoF variants in ANKRD11 were observed in three KBG patients that also presented with ASD (two frameshift, one nonsense), while another frameshift variant in ANKRD11 segregated with disease in a multi-generational pedigree in which a mother with intellectual disability and autistic features transmitted this variant to four affected children, all of whom presented with ASD and intellectual disability. Clinical evaluation of 32 patients with KBG syndrome in Low et al., 2016 found that 8 out of 32 cases (25%) had a formal diagnosis of ASD, with an additional case presenting with some autistic features.

Reports Added
[High Rate of Recurrent De Novo Mutations in Developmental and Epileptic Encephalopathies.2017] [Exome Pool-Seq in neurodevelopmental disorders.2017]
7/1/2017
2S
icon
2S

Score remained at 2S

Description

ANKRD11 is in an ASD-associated multi-genic CNV on chromosome 16q24.3 (Willemsen et al., 2010; Marshall et al., 2008). Two de novo LoF variants in the ANKRD11 gene (both frameshift) have been identified in ASD probands from the Simons Simplex Collection (PMIDs 25284784, 25363768). Mutations in ANKRD11 are also responsible for KBG syndrome (OMIM 148050), which is characterized by developmental delay/intellectual disability and, in some cases, autism (PMID 21782149, 19597979). A comprehensive clinical and genetic evaluation of 20 patients with KBG syndrome from 13 families published in 2014 found that many patients displayed behavioral abnormalities such as ASD (PMID 25424714). In this report, de novo LoF variants in ANKRD11 were observed in three KBG patients that also presented with ASD (two frameshift, one nonsense), while another frameshift variant in ANKRD11 segregated with disease in a multi-generational pedigree in which a mother with intellectual disability and autistic features transmitted this variant to four affected children, all of whom presented with ASD and intellectual disability. Clinical evaluation of 32 patients with KBG syndrome in Low et al., 2016 found that 8 out of 32 cases (25%) had a formal diagnosis of ASD, with an additional case presenting with some autistic features.

Reports Added
[Improved diagnostic yield compared with targeted gene sequencing panels suggests a role for whole-genome sequencing as a first-tier genetic test.2017]
4/1/2017
2S
icon
2S

Score remained at 2S

Description

ANKRD11 is in an ASD-associated multi-genic CNV on chromosome 16q24.3 (Willemsen et al., 2010; Marshall et al., 2008). Two de novo LoF variants in the ANKRD11 gene (both frameshift) have been identified in ASD probands from the Simons Simplex Collection (PMIDs 25284784, 25363768). Mutations in ANKRD11 are also responsible for KBG syndrome (OMIM 148050), which is characterized by developmental delay/intellectual disability and, in some cases, autism (PMID 21782149, 19597979). A comprehensive clinical and genetic evaluation of 20 patients with KBG syndrome from 13 families published in 2014 found that many patients displayed behavioral abnormalities such as ASD (PMID 25424714). In this report, de novo LoF variants in ANKRD11 were observed in three KBG patients that also presented with ASD (two frameshift, one nonsense), while another frameshift variant in ANKRD11 segregated with disease in a multi-generational pedigree in which a mother with intellectual disability and autistic features transmitted this variant to four affected children, all of whom presented with ASD and intellectual disability. Clinical evaluation of 32 patients with KBG syndrome in Low et al., 2016 found that 8 out of 32 cases (25%) had a formal diagnosis of ASD, with an additional case presenting with some autistic features.

Reports Added
[Structural variation of chromosomes in autism spectrum disorder.2008] [Identification of ANKRD11 and ZNF778 as candidate genes for autism and variable cognitive impairment in the novel 16q24.3 microdeletion syndrome.2009] [The contribution of de novo coding mutations to autism spectrum disorder.2014] [Whole exome sequencing in females with autism implicates novel and candidate genes.2015] [Large-scale discovery of novel genetic causes of developmental disorders.2014] [Massively parallel sequencing of patients with intellectual disability, congenital anomalies and/or autism spectrum disorders with a targeted gene ...2014] [Haploinsufficiency of ANKRD11 causes mild cognitive impairment, short stature and minor dysmorphisms.2011] [Mutations in ANKRD11 cause KBG syndrome, characterized by intellectual disability, skeletal malformations, and macrodontia.2011] [Efficient strategy for the molecular diagnosis of intellectual disability using targeted high-throughput sequencing.2014] [Further delineation of the KBG syndrome phenotype caused by ANKRD11 aberrations.2014] [Identification of a novel family of ankyrin repeats containing cofactors for p160 nuclear receptor coactivators.2004] [Subcellular localization of ankyrin repeats cofactor-1 regulates its corepressor activity.2007] [Ankyrin repeats-containing cofactors interact with ADA3 and modulate its co-activator function.2008] [Identification of ANKRD11 as a p53 coactivator.2008] [Haploinsufficiency of ANKRD11 causes mild cognitive impairment, short stature and minor dysmorphisms.2011] [De novo insertions and deletions of predominantly paternal origin are associated with autism spectrum disorder.2014] [Ankrd11 is a chromatin regulator involved in autism that is essential for neural development.2015] [Low load for disruptive mutations in autism genes and their biased transmission.2015] [Effectiveness of exome and genome sequencing guided by acuity of illness for diagnosis of neurodevelopmental disorders.2014] [Exome sequencing in mostly consanguineous Arab families with neurologic disease provides a high potential molecular diagnosis rate.2016] [Meta-analysis of 2,104 trios provides support for 10 new genes for intellectual disability.2016] [High diagnostic yield of syndromic intellectual disability by targeted next-generation sequencing.2016] [Clinical and molecular findings in 39 patients with KBG syndrome caused by deletion or mutation of ANKRD11.2016] [Clinical and genetic aspects of KBG syndrome.2016] [Mutations in Human Accelerated Regions Disrupt Cognition and Social Behavior.2016] [De novo genic mutations among a Chinese autism spectrum disorder cohort.2016] [Clinical exome sequencing: results from 2819 samples reflecting 1000 families.2016] [KBG syndrome involving a single-nucleotide duplication in ANKRD11.2016] [ANKRD11 variants cause variable clinical features associated with KBG syndrome and Coffin-Siris-like syndrome.2017] [Whole genome sequencing resource identifies 18 new candidate genes for autism spectrum disorder.2017] [A clinical utility study of exome sequencing versus conventional genetic testing in pediatric neurology.2017] [Genomic diagnosis for children with intellectual disability and/or developmental delay.2017]
1/1/2017
2S
icon
2S

Score remained at 2S

Description

ANKRD11 is in an ASD-associated multi-genic CNV on chromosome 16q24.3 (Willemsen et al., 2010; Marshall et al., 2008). Two de novo LoF variants in the ANKRD11 gene (both frameshift) have been identified in ASD probands from the Simons Simplex Collection (PMIDs 25284784, 25363768). Mutations in ANKRD11 are also responsible for KBG syndrome (OMIM 148050), which is characterized by developmental delay/intellectual disability and, in some cases, autism (PMID 21782149, 19597979). A comprehensive clinical and genetic evaluation of 20 patients with KBG syndrome from 13 families published in 2014 found that many patients displayed behavioral abnormalities such as ASD (PMID 25424714). In this report, de novo LoF variants in ANKRD11 were observed in three KBG patients that also presented with ASD (two frameshift, one nonsense), while another frameshift variant in ANKRD11 segregated with disease in a multi-generational pedigree in which a mother with intellectual disability and autistic features transmitted this variant to four affected children, all of whom presented with ASD and intellectual disability. Clinical evaluation of 32 patients with KBG syndrome in Low et al., 2016 found that 8 out of 32 cases (25%) had a formal diagnosis of ASD, with an additional case presenting with some autistic features.

Reports Added
[KBG syndrome involving a single-nucleotide duplication in ANKRD11.2016]
10/1/2016
2S
icon
2S

Score remained at 2S

Description

ANKRD11 is in an ASD-associated multi-genic CNV on chromosome 16q24.3 (Willemsen et al., 2010; Marshall et al., 2008). Two de novo LoF variants in the ANKRD11 gene (both frameshift) have been identified in ASD probands from the Simons Simplex Collection (PMIDs 25284784, 25363768). Mutations in ANKRD11 are also responsible for KBG syndrome (OMIM 148050), which is characterized by developmental delay/intellectual disability and, in some cases, autism (PMID 21782149, 19597979). A comprehensive clinical and genetic evaluation of 20 patients with KBG syndrome from 13 families published in 2014 found that many patients displayed behavioral abnormalities such as ASD (PMID 25424714). In this report, de novo LoF variants in ANKRD11 were observed in three KBG patients that also presented with ASD (two frameshift, one nonsense), while another frameshift variant in ANKRD11 segregated with disease in a multi-generational pedigree in which a mother with intellectual disability and autistic features transmitted this variant to four affected children, all of whom presented with ASD and intellectual disability. Clinical evaluation of 32 patients with KBG syndrome in Low et al., 2016 found that 8 out of 32 cases (25%) had a formal diagnosis of ASD, with an additional case presenting with some autistic features.

Reports Added
[High diagnostic yield of syndromic intellectual disability by targeted next-generation sequencing.2016] [Clinical and molecular findings in 39 patients with KBG syndrome caused by deletion or mutation of ANKRD11.2016] [Clinical and genetic aspects of KBG syndrome.2016] [Mutations in Human Accelerated Regions Disrupt Cognition and Social Behavior.2016] [De novo genic mutations among a Chinese autism spectrum disorder cohort.2016] [Clinical exome sequencing: results from 2819 samples reflecting 1000 families.2016]
7/1/2016
2S
icon
2S

Score remained at 2S

Description

ANKRD11 is in an ASD-associated multi-genic CNV on chromosome 16q24.3 (Willemsen et al., 2010; Marshall et al., 2008). Two de novo LoF variants in the ANKRD11 gene (both frameshift) have been identified in ASD probands from the Simons Simplex Collection (PMIDs 25284784, 25363768). Mutations in ANKRD11 are also responsible for KBG syndrome (OMIM 148050), which is characterized by developmental delay/intellectual disability and, in some cases, autism (PMID 21782149, 19597979). A comprehensive clinical and genetic evaluation of 20 patients with KBG syndrome from 13 families published in 2014 found that many patients displayed behavioral abnormalities such as ASD (PMID 25424714). In this report, de novo LoF variants in ANKRD11 were observed in three KBG patients that also presented with ASD (two frameshift, one nonsense), while another frameshift variant in ANKRD11 segregated with disease in a multi-generational pedigree in which a mother with intellectual disability and autistic features transmitted this variant to four affected children, all of whom presented with ASD and intellectual disability.

Reports Added
[Exome sequencing in mostly consanguineous Arab families with neurologic disease provides a high potential molecular diagnosis rate.2016] [Meta-analysis of 2,104 trios provides support for 10 new genes for intellectual disability.2016]
4/1/2016
2S
icon
2S

Score remained at 2S

Description

ANKRD11 is in an ASD-associated multi-genic CNV on chromosome 16q24.3 (Willemsen et al., 2010; Marshall et al., 2008). Two de novo LoF variants in the ANKRD11 gene (both frameshift) have been identified in ASD probands from the Simons Simplex Collection (PMIDs 25284784, 25363768). Mutations in ANKRD11 are also responsible for KBG syndrome (OMIM 148050), which is characterized by developmental delay/intellectual disability and, in some cases, autism (PMID 21782149, 19597979). A comprehensive clinical and genetic evaluation of 20 patients with KBG syndrome from 13 families published in 2014 found that many patients displayed behavioral abnormalities such as ASD (PMID 25424714). In this report, de novo LoF variants in ANKRD11 were observed in three KBG patients that also presented with ASD (two frameshift, one nonsense), while another frameshift variant in ANKRD11 segregated with disease in a multi-generational pedigree in which a mother with intellectual disability and autistic features transmitted this variant to four affected children, all of whom presented with ASD and intellectual disability.

Reports Added
[Structural variation of chromosomes in autism spectrum disorder.2008] [Identification of ANKRD11 and ZNF778 as candidate genes for autism and variable cognitive impairment in the novel 16q24.3 microdeletion syndrome.2009] [The contribution of de novo coding mutations to autism spectrum disorder.2014] [Whole exome sequencing in females with autism implicates novel and candidate genes.2015] [Large-scale discovery of novel genetic causes of developmental disorders.2014] [Massively parallel sequencing of patients with intellectual disability, congenital anomalies and/or autism spectrum disorders with a targeted gene ...2014] [Haploinsufficiency of ANKRD11 causes mild cognitive impairment, short stature and minor dysmorphisms.2011] [Mutations in ANKRD11 cause KBG syndrome, characterized by intellectual disability, skeletal malformations, and macrodontia.2011] [Efficient strategy for the molecular diagnosis of intellectual disability using targeted high-throughput sequencing.2014] [Further delineation of the KBG syndrome phenotype caused by ANKRD11 aberrations.2014] [Identification of a novel family of ankyrin repeats containing cofactors for p160 nuclear receptor coactivators.2004] [Subcellular localization of ankyrin repeats cofactor-1 regulates its corepressor activity.2007] [Ankyrin repeats-containing cofactors interact with ADA3 and modulate its co-activator function.2008] [Identification of ANKRD11 as a p53 coactivator.2008] [Haploinsufficiency of ANKRD11 causes mild cognitive impairment, short stature and minor dysmorphisms.2011] [De novo insertions and deletions of predominantly paternal origin are associated with autism spectrum disorder.2014] [Ankrd11 is a chromatin regulator involved in autism that is essential for neural development.2015] [Low load for disruptive mutations in autism genes and their biased transmission.2015] [Effectiveness of exome and genome sequencing guided by acuity of illness for diagnosis of neurodevelopmental disorders.2014]
1/1/2016
2S
icon
2S

Score remained at 2S

Description

ANKRD11 is in an ASD-associated multi-genic CNV on chromosome 16q24.3 (Willemsen et al., 2010; Marshall et al., 2008). Two de novo LoF variants in the ANKRD11 gene (both frameshift) have been identified in ASD probands from the Simons Simplex Collection (PMIDs 25284784, 25363768). Mutations in ANKRD11 are also responsible for KBG syndrome (OMIM 148050), which is characterized by developmental delay/intellectual disability and, in some cases, autism (PMID 21782149, 19597979). A comprehensive clinical and genetic evaluation of 20 patients with KBG syndrome from 13 families published in 2014 found that many patients displayed behavioral abnormalities such as ASD (PMID 25424714). In this report, de novo LoF variants in ANKRD11 were observed in three KBG patients that also presented with ASD (two frameshift, one nonsense), while another frameshift variant in ANKRD11 segregated with disease in a multi-generational pedigree in which a mother with intellectual disability and autistic features transmitted this variant to four affected children, all of whom presented with ASD and intellectual disability.

Reports Added
[Structural variation of chromosomes in autism spectrum disorder.2008] [Identification of ANKRD11 and ZNF778 as candidate genes for autism and variable cognitive impairment in the novel 16q24.3 microdeletion syndrome.2009] [The contribution of de novo coding mutations to autism spectrum disorder.2014] [Whole exome sequencing in females with autism implicates novel and candidate genes.2015] [Large-scale discovery of novel genetic causes of developmental disorders.2014] [Massively parallel sequencing of patients with intellectual disability, congenital anomalies and/or autism spectrum disorders with a targeted gene ...2014] [Haploinsufficiency of ANKRD11 causes mild cognitive impairment, short stature and minor dysmorphisms.2011] [Mutations in ANKRD11 cause KBG syndrome, characterized by intellectual disability, skeletal malformations, and macrodontia.2011] [Efficient strategy for the molecular diagnosis of intellectual disability using targeted high-throughput sequencing.2014] [Further delineation of the KBG syndrome phenotype caused by ANKRD11 aberrations.2014] [Identification of a novel family of ankyrin repeats containing cofactors for p160 nuclear receptor coactivators.2004] [Subcellular localization of ankyrin repeats cofactor-1 regulates its corepressor activity.2007] [Ankyrin repeats-containing cofactors interact with ADA3 and modulate its co-activator function.2008] [Identification of ANKRD11 as a p53 coactivator.2008] [Haploinsufficiency of ANKRD11 causes mild cognitive impairment, short stature and minor dysmorphisms.2011] [De novo insertions and deletions of predominantly paternal origin are associated with autism spectrum disorder.2014] [Ankrd11 is a chromatin regulator involved in autism that is essential for neural development.2015] [Low load for disruptive mutations in autism genes and their biased transmission.2015]
1/1/2015
2S
icon
2S

Score remained at 2S

Description

ANKRD11 is in an ASD-associated multi-genic CNV on chromosome 16q24.3 (Willemsen et al., 2010; Marshall et al., 2008). Two de novo LoF variants in the ANKRD11 gene (both frameshift) have been identified in ASD probands from the Simons Simplex Collection (PMIDs 25284784, 25363768). Mutations in ANKRD11 are also responsible for KBG syndrome (OMIM 148050), which is characterized by developmental delay/intellectual disability and, in some cases, autism (PMID 21782149, 19597979). A comprehensive clinical and genetic evaluation of 20 patients with KBG syndrome from 13 families published in 2014 found that many patients displayed behavioral abnormalities such as ASD (PMID 25424714). In this report, de novo LoF variants in ANKRD11 were observed in three KBG patients that also presented with ASD (two frameshift, one nonsense), while another frameshift variant in ANKRD11 segregated with disease in a multi-generational pedigree in which a mother with intellectual disability and autistic features transmitted this variant to four affected children, all of whom presented with ASD and intellectual disability.

Reports Added
[Whole exome sequencing in females with autism implicates novel and candidate genes.2015] [Large-scale discovery of novel genetic causes of developmental disorders.2014] [Efficient strategy for the molecular diagnosis of intellectual disability using targeted high-throughput sequencing.2014] [Ankrd11 is a chromatin regulator involved in autism that is essential for neural development.2015]
10/1/2014
4
icon
2S

Decreased from 4 to 2S

Description

ANKRD11 is in an ASD-associated multi-genic CNV on chromosome 16q24.3 (Willemsen et al., 2010; Marshall et al., 2008). Two de novo LoF variants in the ANKRD11 gene (both frameshift) have been identified in ASD probands from the Simons Simplex Collection (PMIDs 25284784, 25363768). Mutations in ANKRD11 are also responsible for KBG syndrome (OMIM 148050), which is characterized by developmental delay/intellectual disability and, in some cases, autism (PMID 21782149, 19597979). A comprehensive clinical and genetic evaluation of 20 patients with KBG syndrome from 13 families published in 2014 found that many patients displayed behavioral abnormalities such as ASD (PMID 25424714). In this report, de novo LoF variants in ANKRD11 were observed in three KBG patients that also presented with ASD (two frameshift, one nonsense), while another frameshift variant in ANKRD11 segregated with disease in a multi-generational pedigree in which a mother with intellectual disability and autistic features transmitted this variant to four affected children, all of whom presented with ASD and intellectual disability.

Reports Added
[De novo insertions and deletions of predominantly paternal origin are associated with autism spectrum disorder.2014] [The contribution of de novo coding mutations to autism spectrum disorder.2014] [Further delineation of the KBG syndrome phenotype caused by ANKRD11 aberrations.2014]
7/1/2014
No data
icon
4

Increased from No data to 4

Description

ANKRD11 is in an ASD-associated multi-genic CNV on chromosome 16q24.3 (Willemsen et al., 2010; Marshall et al., 2008).

4/1/2014
No data
icon
4

Increased from No data to 4

Description

ANKRD11 is in an ASD-associated multi-genic CNV on chromosome 16q24.3 (Willemsen et al., 2010; Marshall et al., 2008).

Reports Added
[Massively parallel sequencing of patients with intellectual disability, congenital anomalies and/or autism spectrum disorders with a targeted gene ...2014]
Krishnan Probability Score

Score 0.49683458187312

Ranking 2497/25841 scored genes


[Show Scoring Methodology]
Krishnan and colleagues generated probability scores genome-wide by using a machine learning approach on a human brain-specific gene network. The method was first presented in Nat Neurosci 19, 1454-1462 (2016), and scores for more than 25,000 RefSeq genes can be accessed in column G of supplementary table 3 (see: http://www.nature.com/neuro/journal/v19/n11/extref/nn.4353-S5.xlsx). A searchable browser, with the ability to view networks of associated ASD risk genes, can be found at asd.princeton.edu.
Original Source
ExAC Score

Score 0.99999982163224

Ranking 214/18225 scored genes


[Show Scoring Methodology]
The Exome Aggregation Consortium (ExAC) is a summary database of 60,706 exomes that has been widely used to estimate 'constraint' on mutation for individual genes. It was introduced by Lek et al. Nature 536, 285-291 (2016), and the ExAC browser can be found at exac.broadinstitute.org. The pLI score was developed as measure of intolerance to loss-of- function mutation. A pLI > 0.9 is generally viewed as highly constrained, and thus any loss-of- function mutations in autism in such a gene would be more likely to confer risk. For a full list of pLI scores see: ftp://ftp.broadinstitute.org/pub/ExAC_release/release0.3.1/functional_gene_constraint/fordist_cle aned_exac_nonTCGA_z_pli_rec_null_data.txt
Original Source
Iossifov Probability Score

Score 1

Ranking 1/239 scored genes


[Show Scoring Methodology]
Supplementary dataset S2 in the paper by Iossifov et al. (PNAS 112, E5600-E5607 (2015)) lists 239 genes with a probability of at least 0.8 of being associated with autism risk (column I). This probability metric combines the evidence from de novo likely-gene- disrupting and missense mutations and assesses it against the background mutation rate in unaffected individuals from the University of Washington’s Exome Variant Sequence database (evs.gs.washington.edu/EVS/). The list of probability scores can be found here: www.pnas.org/lookup/suppl/doi:10.1073/pnas.1516376112/- /DCSupplemental/pnas.1516376112.sd02.xlsx
Original Source
Sanders TADA Score

Score 0.40237920709992

Ranking 282/18665 scored genes


[Show Scoring Methodology]
The TADA score ('Transmission and De novo Association') was introduced by He et al. PLoS Genet 9(8):e1003671 (2013), and is a statistic that integrates evidence from both de novo and transmitted mutations. It forms the basis for the claim of 65 individual genes being strongly associated with autism risk at a false discovery rate of 0.1 (Sanders et al. Neuron 87, 1215-1233 (2015)). The calculated TADA score for 18,665 RefSeq genes can be found in column P of Supplementary Table 6 in the Sanders et al. paper (the column headed 'tadaFdrAscSscExomeSscAgpSmallDel'), which represents a combined analysis of exome data and small de novo deletions (see www.cell.com/cms/attachment/2038545319/2052606711/mmc7.xlsx).
Original Source
Larsen Cumulative Evidence Score

Score 70

Ranking 19/461 scored genes


[Show Scoring Methodology]
Larsen and colleagues generated gene scores based on the sum of evidence for all available ASD-associated variants in a gene, with assessments based on mode of inheritance, effect size, and variant frequency in the general population. The approach was first presented in Mol Autism 7:44 (2016), and scores for 461 genes can be found in column I in supplementary table 4 from that paper.
Original Source
Zhang D Score

Score 0.18451936412407

Ranking 4526/20870 scored genes


[Show Scoring Methodology]
The DAMAGES score (disease-associated mutation analysis using gene expression signatures), or D score, was developed to combine evidence from de novo loss-of- function mutation with evidence from cell-type- specific gene expression in the mouse brain (specifically translational profiles of 24 specific mouse CNS cell types isolated from 6 different brain regions). Genes with positive D scores are more likely to be associated with autism risk, with higher-confidence genes having higher D scores. This statistic was first presented by Zhang & Shen (Hum Mutat 38, 204- 215 (2017), and D scores for more than 20,000 RefSeq genes can be found in column M in supplementary table 2 from that paper.
Original Source
CNVs associated with ANKRD11(1 CNVs)
Sort By:
16q24.3 24 Deletion-Duplication 36  /  103
External PIN Data
BioGRIDHuman Protein Reference Database
Interactome
Interaction Table
Interactor Symbol Interactor Name Interactor Organism Interactor Type Entrez ID Uniprot ID
BZRAP1 benzodiazapine receptor (peripheral) associated protein 1 Human Protein Binding 9256 O95153
CDCA7L cell division cycle associated 7-like Human Protein Binding 55536 Q96GN5
Fzd3 frizzled homolog 3 (Drosophila) Mouse Direct Regulation 14365 Q61086
GPS2 G protein pathway suppressor 2 Human Protein Binding 2874 Q13227
HDAC3 Histone deacetylase 3 Human Protein Binding 8841 O15379
HDAC4 histone deacetylase 4 Human Protein Binding 9759 P56524
HDAC5 Histone deacetylase 5 Human Protein Binding 10014 Q9UQL6
HOOK2 hook homolog 2 (Drosophila) Human Protein Binding 29911 Q96ED9
IKZF1 IKAROS family zinc finger 1 (Ikaros) Human Protein Binding 10320 Q13422
KIAA1712 centrosomal protein 44kDa Human Protein Binding NM_001040157 Q9C0F1
Kmt2e lysine (K)-specific methyltransferase 2E Mouse Direct Regulation 69188 Q3UG20
MKRN3 makorin ring finger protein 3 Human Protein Binding 7681 Q13064
NCOA2 nuclear receptor coactivator 2 Human Protein Binding 10499 Q15596
NCOA3 nuclear receptor coactivator 3 Human Protein Binding 8202 Q9Y6Q9
Ncor1 nuclear receptor co-repressor 1 Mouse Direct Regulation 20185 Q60974
Notch1 notch 1 Mouse Direct Regulation 18128 Q01705
PDE4DIP phosphodiesterase 4D interacting protein Human Protein Binding 9659 Q5VU43
Slc1a2 solute carrier family 1 (glial high affinity glutamate transporter), member 2 Mouse Direct Regulation 20511 P43006
Sox6 SRY-box containing gene 6 Mouse Direct Regulation 20679 P40645
TADA3 transcriptional adaptor 3 Human Protein Binding 10474 O75528
TFIP11 tuftelin interacting protein 11 Human Protein Binding 24144 Q9UBB9
TRIM37 tripartite motif containing 37 Human Protein Binding NM_015294 A8K0V9
Submit New Gene

Report an Error